Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BS00105833_51

[Submit comment/correction]

Sequence	BS00105833_51
Contig	1BS_3415168
Probe	BS00105833_51
DNA Homology	1BS_3415168 Best IWGSC match 139 7e-31 URGI_Best IWGSC_N
BLAST, e-value	7e-31 1BS_3415168 Best IWGSC match
DNA	tggttcttttggcctatccaatccacctgctcaggatcagacccttcctc Raagtaaaactccggccgtccacccttgctaggatcgaacccgggcttca t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.