Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RAC875_c51663_87

[Submit comment/correction]

Sequence	RAC875_c51663_87
Contig	2AL_1021437
Probe	RAC875_c51663_87
DNA Homology	2AL_1021437 Best IWGSC match 110 5e-22 URGI_Best IWGSC_N
BLAST, e-value	5e-22 2AL_1021437 Best IWGSC match
DNA	ggaagcatcaactactaccatagaccactgagatctggcaagtgggctgt Racttatgaggaatggccagaggaggcttacccaagttatgccaatgggc c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.