Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RAC875_c32874_804

[Submit comment/correction]

Sequence	RAC875_c32874_804
Contig	1DS_1882269
Probe	RAC875_c32874_804
DNA Homology	1DS_1882269 Best IWGSC match 159 5e-37 URGI_Best IWGSC_N
BLAST, e-value	5e-37 1DS_1882269 Best IWGSC match
DNA	tgtcgttgcgcaccagctggaacgtctccgactcccccggtgtggaggct Rtggcccccacattaacgccggcaacggtcacgaactggttgctgaacac c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.