Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_RFL_Contig4080_4587633

[Submit comment/correction]

Sequence	wsnp_RFL_Contig4080_4587633
Contig	1BS_3481575
Probe	wsnp_RFL_Contig4080_4587633
DNA Homology	1BS_3481575 Best IWGSC match 143 4e-32 URGI_Best IWGSC_N
BLAST, e-value	4e-32 1BS_3481575 Best IWGSC match
DNA	catcgagcacgatcccaaggtggggcgcRacgtctacacccggtttttcc tcagggacttctccgtcttcaacatcgac

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.