Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: GENE-0427_442

[Submit comment/correction]

Sequence	GENE-0427_442
Contig	1BS_3474185
Probe	GENE-0427_442
DNA Homology	1BS_3474185 Best IWGSC match 135 6e-30 URGI_Best IWGSC_N
BLAST, e-value	6e-30 1BS_3474185 Best IWGSC match
DNA	tgttcaggagggaacggttgtcacggcttatacctcgcctgatagtcgcc Rctgtaatggagcgatgctggaggaaatg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.