Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 1DS_1886991

[Submit comment/correction]

Sequence	TA005699-1050
Contig	1DS_1886991
Probe	TA005699-1050
DNA Homology	1DS_1886991 Best IWGSC match 97 2e-18 URGI_Best IWGSC_N
BLAST, e-value	2e-18 1DS_1886991 Best IWGSC match
DNA	tcaccgagtgcgacacaatccccatttccagtatctgcaggaaccaaaat Maat

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.