Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Ra_c27867_685

[Submit comment/correction]

Sequence	Ra_c27867_685
Contig	5DS_2739401
Probe	Ra_c27867_685
DNA Homology	5DS_2739401 Best IWGSC match 139 7e-31 URGI_Best IWGSC_N
BLAST, e-value	7e-31 5DS_2739401 Best IWGSC match
DNA	agtgcccagatgctgaagtgcgagcggtactcagcttcggacatcccacc Rtttccaacttcaagcatatcaggatcgttccatccaccaggtccagcgt a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.