Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BS00051105_51

[Submit comment/correction]

Sequence	BS00051105_51
Contig	1BS_3483538
Probe	BS00051105_51
DNA Homology	1BS_3483538 Best IWGSC match 169 8e-40 URGI_Best IWGSC_N
BLAST, e-value	8e-40 1BS_3483538 Best IWGSC match
DNA	gcaagggcctgtcggcggaggccctgtgcaacctgaggagctggctggag Rctgaccgctagctctctggcttgagatgcctgctctgctcctgctccta c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.