Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: IAAV6948

[Submit comment/correction]

Sequence	IAAV6948
Contig	1DS_1888591
Probe	IAAV6948
DNA Homology	1DS_1888591 Best IWGSC match 187 5.60519e-45 URGI_Best IWGSC_N
BLAST, e-value	5.60519e-45 1DS_1888591 Best IWGSC match
DNA	nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnng tggaatcaagtgaagttgacctatctgattttcaagatgcacctcttgat Matgatgatgaacagccagtacaaggagatgctactcaacaagatggtcc agannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn n

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.