Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: IACX6356

[Submit comment/correction]

Sequence	IACX6356
Contig	1BS_3445781
Probe	IACX6356
DNA Homology	1BS_3445781 Best IWGSC match 154 3e-35 URGI_Best IWGSC_N
BLAST, e-value	3e-35 1BS_3445781 Best IWGSC match
DNA	ctaaagagcatactttcttcttctcttgtaccctggtgtggcctagaggt ccgaagcatRtctgccaatacagaaggccttcttttttttgggaaaagaa ctgagatctattataaagat

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.