Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: GENE-0459_114

[Submit comment/correction]

Sequence	GENE-0459_114
Contig	1DS_1898395
Probe	GENE-0459_114
DNA Homology	1DS_1898395 Best IWGSC match 169 8e-40 URGI_Best IWGSC_N
BLAST, e-value	8e-40 1DS_1898395 Best IWGSC match
DNA	tccagtcaggaaaggtaccagcccacaacccgcatttaaccgatcagcta Rcaatgcgcaagrtttgccaaactgaacctaactaactatctgcacc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.