Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_Ex_rep_c66643_64952627

[Submit comment/correction]

Sequence	wsnp_Ex_rep_c66643_64952627
Contig	1BL_3841189
Probe	wsnp_Ex_rep_c66643_64952627
DNA Homology	1BL_3841189 Best IWGSC match 243 0 URGI_Best IWGSC_N
BLAST, e-value	0 1BL_3841189 Best IWGSC match
DNA	agcagggaccaacacccaagatccatcaagagccgcatcagacaatgatg ggcaaccaaaccagaaacggcagcatcattcagcaccaatgaccacaaag Rtaacagcatcattcagcagtctggaaacagaa

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.