Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 1BL_3800637

[Submit comment/correction]

Sequence	IACX2578
Contig	1BL_3800637
Probe	IACX2578
DNA Homology	1BL_3800637 Best IWGSC match 159 6e-37 URGI_Best IWGSC_N
BLAST, e-value	6e-37 1BL_3800637 Best IWGSC match
DNA	tcctggtcatggggatcctctcacacgtgaacgccgactatttccccaag tgctgcaacaRttgcaggtccttctcgggggtcgacgtctgcgacgacgc ccacccccagtgccccaagg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.