Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RAC875_c5556_328

[Submit comment/correction]

Sequence	RAC875_c5556_328
Contig	5BL_10922627
Probe	RAC875_c5556_328
DNA Homology	5BL_10922627 Best IWGSC match 147 4e-33 URGI_Best IWGSC_N
BLAST, e-value	4e-33 5BL_10922627 Best IWGSC match
DNA	ccattcgccaggtcttcgatcttggcaagatgaaagacaaggcgtggggc Rtcaggtgaaccaaactgcagcaggccttccacgaaccgggagcgaggag a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.