Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 1BL_3794722

[Submit comment/correction]

Sequence	Excalibur_c24663_1042
Contig	1BL_3794722
Probe	Excalibur_c24663_1042
DNA Homology	1BL_3794722 Best IWGSC match 156 7e-36 URGI_Best IWGSC_N
BLAST, e-value	7e-36 1BL_3794722 Best IWGSC match
DNA	tctcggtgaaggagaatcggtaacgccatccctccacccccacactcgtc Rtcctcctccccttgattcaccaatgccagatctgaacaggagatccgtg a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.