Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Excalibur_c60106_73

[Submit comment/correction]

Sequence	Excalibur_c60106_73
Contig	1BL_3917830
Probe	Excalibur_c60106_73
DNA Homology	1BL_3917830 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value	2.94273e-44 1BL_3917830 Best IWGSC match
DNA	gatgcgcgcatgcgtggcgaccacgatgtcaatagcgtgtggaaaattgc Rgacaccgcattgaagtgtacggcacaaaagcccggagagcggcccacga t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.