Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BobWhite_c17032_179

[Submit comment/correction]

Sequence	BobWhite_c17032_179
Contig	1BL_3910003
Probe	BobWhite_c17032_179
DNA Homology	1BL_3910003 Best IWGSC match 117 3e-24 URGI_Best IWGSC_N
BLAST, e-value	3e-24 1BL_3910003 Best IWGSC match
DNA	tcgaacttgagccccatcctcttgccaccatccttcccggggagcgggtt Rtagtagccgaggacctcgaggtgcttgccgtcgcaacgggagcggctgt c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.