Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: IACX8280

[Submit comment/correction]

Sequence	IACX8280
Contig	1DL_2278118
Probe	IACX8280
DNA Homology	1DL_2278118 Best IWGSC match 228 0 URGI_Best IWGSC_N
BLAST, e-value	0 1DL_2278118 Best IWGSC match
DNA	tcggccctgcctgatgctttctggaaccccaaacctgtcccttcgcgcga ggggtgaagtcgcaatgcaaatgtacatacccatctcctttcagcgcctg Scccgccgtccttctgtggaagtaa

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.