Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_RFL_Contig395_4387107

[Submit comment/correction]

Sequence	wsnp_RFL_Contig395_4387107
Contig	1DL_2240289
Probe	wsnp_RFL_Contig395_4387107
DNA Homology	1DL_2240289 Best IWGSC match 139 7e-31 URGI_Best IWGSC_N
BLAST, e-value	7e-31 1DL_2240289 Best IWGSC match
DNA	tctgtcgtcacggctgcggataagggaggtgctacccatgttgatatagc Rtgtgaccaggacttggtaaagcttgcgctggagcttactaaccttccga t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.