Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: GENE-0014_822

[Submit comment/correction]

Sequence	GENE-0014_822
Contig	1AS_3282639
Probe	GENE-0014_822
DNA Homology	1AS_3282639 Best IWGSC match 174 1.99993e-41 URGI_Best IWGSC_N
BLAST, e-value	1.99993e-41 1AS_3282639 Best IWGSC match
DNA	ttgccaactctgcaagcaaaccaatgaagagagaaatgatgaaccaggga Macatggtctgtcataaggactcagcaaggtagcaaacgctgtcctaacc g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.