Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Excalibur_c27057_694

[Submit comment/correction]

Sequence	Excalibur_c27057_694
Contig	1DL_2246044
Probe	Excalibur_c27057_694
DNA Homology	1DL_2246044 Best IWGSC match 178 1.00053e-42 URGI_Best IWGSC_N
BLAST, e-value	1.00053e-42 1DL_2246044 Best IWGSC match
DNA	tccccatggccatagtgatcatagtgctcatcaccatacagatcaccctc Rccatagttatcatatcccccattgccatagtagtcatcttcatcatcat t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.