Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: IAAV7181

[Submit comment/correction]

Sequence	IAAV7181
Contig	1DL_2228369
Probe	IAAV7181
DNA Homology	1DL_2228369 Best IWGSC match 233 0 URGI_Best IWGSC_N
BLAST, e-value	0 1DL_2228369 Best IWGSC match
DNA	ctgtgatccactttgccgggctgaaagccgtcggggagagcgtggacaag cccctgctttactacgacaacaacctcatcggcaccatcaccctcctcca Rgtcatggccgcacatggctgcaagaagcnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn n

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.