Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 1DL_2290767

[Submit comment/correction]

Sequence	CAP12_c523_58
Contig	1DL_2290767
Probe	CAP12_c523_58
DNA Homology	1DL_2290767 Best IWGSC match 152 8e-35 URGI_Best IWGSC_N
BLAST, e-value	8e-35 1DL_2290767 Best IWGSC match
DNA	cgagagtggtaccttacggccgggcaaataagaggtgtggtctggcgggg Rtgtctcagccaggcagcggctaccacgggcgggcgtgccgtggtcttct t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.