Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RAC875_s118797_203

[Submit comment/correction]

Sequence	RAC875_s118797_203
Contig	1DL_2251150
Probe	RAC875_s118797_203
DNA Homology	1DL_2251150 Best IWGSC match 154 2e-35 URGI_Best IWGSC_N
BLAST, e-value	2e-35 1DL_2251150 Best IWGSC match
DNA	caacgcccggtggagactctgcgtcggcgggggtcaagagagggcgtggg Mggccaagaaaggagaggccagaggcagcgatttctgctgaaagtggaga t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.