Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BobWhite_c42696_188

[Submit comment/correction]

Sequence	BobWhite_c42696_188
Contig	1DL_2227499
Probe	BobWhite_c42696_188
DNA Homology	1DL_2227499 Best IWGSC match 121 2e-25 URGI_Best IWGSC_N
BLAST, e-value	2e-25 1DL_2227499 Best IWGSC match
DNA	ctggtgaacaagctcttcgaggaagagcggaccaaggaatgggccgaggg Rtctctggaagagaaggtgcagcggctgctcaagacctgggagatggagt t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.