Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 1DL_13206

[Submit comment/correction]

Sequence	wsnp_Ku_c1827_3575162
Contig	1DL_13206
Probe	wsnp_Ku_c1827_3575162
DNA Homology	1DL_13206 Best IWGSC match 73 2e-10 URGI_Best IWGSC_N
BLAST, e-value	2e-10 1DL_13206 Best IWGSC match
DNA	gggagaccgagaaaggagagaccaccagaagcaatgtccgctgaagctgg agatgcagcagcgcctgctcctgaaactggaaatgcagcagcgcctgctt Mtgaaactggaaatgcagcagcgcatgctccagaagctggagatgcaact cctgctcttgaaaccggagatgcaactcctgctccgcctgctgaaactgg a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.