Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RAC875_rep_c112793_273

[Submit comment/correction]

Sequence	RAC875_rep_c112793_273
Contig	2AS_5294583
Probe	RAC875_rep_c112793_273
DNA Homology	2AS_5294583 Best IWGSC match 159 5e-37 URGI_Best IWGSC_N
BLAST, e-value	5e-37 2AS_5294583 Best IWGSC match
DNA	atggtgagaagatcttggttatatgcatctccaccaagagtaaatgtgtg Mactggaactttggagatgaagccctgaactccatcaaagaagtcgccct t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.