Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: IACX11199

[Submit comment/correction]

Sequence	IACX11199
Contig	2BS_5167918
Probe	IACX11199
DNA Homology	2BS_5167918 Best IWGSC match 158 4e-36 URGI_Best IWGSC_N
BLAST, e-value	4e-36 2BS_5167918 Best IWGSC match
DNA	nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncaagaggccg ccttggaggcgttaattcagctggaatagctttctatgaccgcctgattg Mtgcactcgtgcagaaagggatagagccatttgtgacactgcatcacttt gatctgccgcacgaaatggagacccgatacgggggttggttgggcgccgg a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.