Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_RFL_Contig3790_4082085

[Submit comment/correction]

Sequence	wsnp_RFL_Contig3790_4082085
Contig	3AL_4452097
Probe	wsnp_RFL_Contig3790_4082085
DNA Homology	3AL_4452097 Best IWGSC match 111 1e-22 URGI_Best IWGSC_N
BLAST, e-value	1e-22 3AL_4452097 Best IWGSC match
DNA	tcctgcgatctgcatacattcgggaatgacacaggaggagaggctgaccc Rgtataagaatttcaaggaagggcacaagaggatccttgtggctacggat t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.