Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Kukri_c33779_1099

[Submit comment/correction]

Sequence	Kukri_c33779_1099
Contig	2DS_5352598
Probe	Kukri_c33779_1099
DNA Homology	2DS_5352598 Best IWGSC match 154 2e-35 URGI_Best IWGSC_N
BLAST, e-value	2e-35 2DS_5352598 Best IWGSC match
DNA	tcgaattccttacctgatagtgtgtcacggatgcgtgcaccaatgaccct Mtctcctgattcatccttaatgagggagaccacttcagcataattgagaa c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.