Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_Ku_c15567_24223777

[Submit comment/correction]

Sequence	wsnp_Ku_c15567_24223777
Contig	2DS_5341072
Probe	wsnp_Ku_c15567_24223777
DNA Homology	2DS_5341072 Best IWGSC match 196 0 URGI_Best IWGSC_N
BLAST, e-value	0 2DS_5341072 Best IWGSC match
DNA	ggcccttctgcttggcctcatgtgccctccttgcacgagacctggagtgg atcttctgaggcttcctgatgatgaaaccatccttcaccagcttccggat Rttctgccgggagttggccatggagatctcgttgacctcattggggtcga gccagaccttgcccttgccgcacttgaggacgctcgaggccaagcgcttc t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.