Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BobWhite_c1634_563

[Submit comment/correction]

Sequence	BobWhite_c1634_563
Contig	6AL_5768381
Probe	BobWhite_c1634_563
DNA Homology	6AL_5768381 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value	2.94273e-44 6AL_5768381 Best IWGSC match
DNA	ggacgcgcggagcggtcaccgcctgtgctatgaaccggcgacgtcttgct Rctacgagcggtgaccgacgaggtgcgggacgaccagcggcgacgcgagg t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.