Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: GENE-1020_150

[Submit comment/correction]

Sequence	GENE-1020_150
Contig	2BS_5175424
Probe	GENE-1020_150
DNA Homology	2BS_5175424 Best IWGSC match 115 6e-24 URGI_Best IWGSC_N
BLAST, e-value	6e-24 2BS_5175424 Best IWGSC match
DNA	cagtgagcatcaatgggcaaatgcaaggacaaagggactcacccctcaat Ragctgaggcttgcctan

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.