Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 2AL_6317016

[Submit comment/correction]

Sequence	BS00032606_51
Contig	2AL_6317016
Probe	BS00032606_51
DNA Homology	2AL_6317016 Best IWGSC match 176 4.99983e-42 URGI_Best IWGSC_N
BLAST, e-value	4.99983e-42 2AL_6317016 Best IWGSC match
DNA	ccatctgtggccgtgagaaggacggcgtagacgaggaggaggacgcgagg Mggcgaccctgttcttgacggctccgccacggccatggccggaatactcg a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.