Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 2AS_5307209

[Submit comment/correction]

Sequence	RAC875_rep_c74200_1415
Contig	2AS_5307209
Probe	RAC875_rep_c74200_1415
DNA Homology	2AS_5307209 Best IWGSC match 171 2e-40 URGI_Best IWGSC_N
BLAST, e-value	2e-40 2AS_5307209 Best IWGSC match
DNA	ttaagcataacctttgcacatccctctgcaatctgtgcaagcgtgataag Mgcagcatggtgcttctgccactctggagcagaaagatattgtgggagca g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.