Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 2AL_6386928

[Submit comment/correction]

Sequence	BobWhite_rep_c64766_352
Contig	2AL_6386928
Probe	BobWhite_rep_c64766_352
DNA Homology	2AL_6386928 Best IWGSC match 152 8e-35 URGI_Best IWGSC_N
BLAST, e-value	8e-35 2AL_6386928 Best IWGSC match
DNA	catgattcagtactacgcttcagctggaaaggaacacacacaacacaacg Mtacctaggccttcctgcagacgtctccctcgcacgcgtacccagctggg c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.