Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 2AL_6423344

[Submit comment/correction]

Sequence	TA001297-0826
Contig	2AL_6423344
Probe	TA001297-0826
DNA Homology	2AL_6423344 Best IWGSC match 94 2e-17 URGI_Best IWGSC_N
BLAST, e-value	2e-17 2AL_6423344 Best IWGSC match
DNA	acaagactcgtctgatcccttgtcctctactcaatgccatgagatccaat R

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.