Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 2AL_6383989

[Submit comment/correction]

Sequence	wsnp_Ex_c41007_47932833
Contig	2AL_6383989
Probe	wsnp_Ex_c41007_47932833
DNA Homology	2AL_6383989 Best IWGSC match 259 0 URGI_Best IWGSC_N
BLAST, e-value	0 2AL_6383989 Best IWGSC match
DNA	cttccaaacatcaggggcagggccgtctttcttctttcagggttactggg ccttgccctccgcgaccgcttccatcccagaagatgctcccatgccttcg Ratggcttcccggcgccgtaaggagctttgctcaccaccctgtcacggcg cttctccaggaagcgctgaagggagtgtctcctggcgatgggaagatcag c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.