Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RAC875_c1043_258

[Submit comment/correction]

Sequence	RAC875_c1043_258
Contig	2DL_9858407
Probe	RAC875_c1043_258
DNA Homology	2DL_9858407 Best IWGSC match 176 4.99983e-42 URGI_Best IWGSC_N
BLAST, e-value	4.99983e-42 2DL_9858407 Best IWGSC match
DNA	aagagagctgatctgattgctgcgcttggggagaccaccgggaagccagc Rttcgagcgtgtgctccagcgcatgaagaacagcgccgaaggcagggaaa t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.