Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 2BS_5198799

[Submit comment/correction]

Sequence	Excalibur_c2933_1350
Contig	2BS_5198799
Probe	Excalibur_c2933_1350
DNA Homology	2BS_5198799 Best IWGSC match 158 2e-36 URGI_Best IWGSC_N
BLAST, e-value	2e-36 2BS_5198799 Best IWGSC match
DNA	acattgtgtcccatgagcgggaacaagcttcgcagcatatggtatccacc Rtgcagacctgcatgaatgaaaacgggtgcacggtagaggaggcaaatga a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.