Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_RFL_Contig3118_3061389

[Submit comment/correction]

Sequence	wsnp_RFL_Contig3118_3061389
Contig	2DS_5376916
Probe	wsnp_RFL_Contig3118_3061389
DNA Homology	2DS_5376916 Best IWGSC match 135 9e-30 URGI_Best IWGSC_N
BLAST, e-value	9e-30 2DS_5376916 Best IWGSC match
DNA	atcagacctagtttgacaccatgcttcttgacaaattcatccttgtagtc Mgaccgcagcttcatcaaattggtcatgtcaacttcattgaatgtggtca g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.