Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: CAP7_rep_c6321_329

[Submit comment/correction]

Sequence	CAP7_rep_c6321_329
Contig	5DL_4491306
Probe	CAP7_rep_c6321_329
DNA Homology	5DL_4491306 Best IWGSC match 176 4.99983e-42 URGI_Best IWGSC_N
BLAST, e-value	4.99983e-42 5DL_4491306 Best IWGSC match
DNA	agtacccaggggatgcgttgtgcgtcacggaagatgaacccaaccttgct Raactcgaggcaaggcacccacttggagcggatcaggtagtcgacctgct t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.