Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: GENE-1768_130

[Submit comment/correction]

Sequence	GENE-1768_130
Contig	2BS_5247261
Probe	GENE-1768_130
DNA Homology	2BS_5247261 Best IWGSC match 176 4.99983e-42 URGI_Best IWGSC_N
BLAST, e-value	4.99983e-42 2BS_5247261 Best IWGSC match
DNA	ctcctccctaccaggccctactgaactctgaagaactcgctggactgggg Rtcacggccgcccaactgctgggccgacagagccgcggcgatgctgagcg c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.