Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: GENE-1421_124

[Submit comment/correction]

Sequence	GENE-1421_124
Contig	2DS_5387080
Probe	GENE-1421_124
DNA Homology	2DS_5387080 Best IWGSC match 115 9e-24 URGI_Best IWGSC_N
BLAST, e-value	9e-24 2DS_5387080 Best IWGSC match
DNA	tatgagcgttgcagcatctaagagattcatggtgagattaagcaaaagca Rtygtaacatttttayycaagayyctttnnnnnnn

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.