Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 2BS_5160747

[Submit comment/correction]

Sequence	BS00009807_51
Contig	2BS_5160747
Probe	BS00009807_51
DNA Homology	2BS_5160747 Best IWGSC match 167 3e-39 URGI_Best IWGSC_N
BLAST, e-value	3e-39 2BS_5160747 Best IWGSC match
DNA	tcggagagggaccgtccgatcgagaataaggacctggtgctgtggtacac Rttggggttccaccacatcccttgtcaggaggacttccccatcatgccca c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.