Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 2DL_9755806

[Submit comment/correction]

Sequence	wsnp_BG275030A_Td_2_1
Contig	2DL_9755806
Probe	wsnp_BG275030A_Td_2_1
DNA Homology	2DL_9755806 Best IWGSC match 163 4e-38 URGI_Best IWGSC_N
BLAST, e-value	4e-38 2DL_9755806 Best IWGSC match
DNA	AATTCAGYTACAATGGTTTTTTTTTTCATTTCTGACGCTTCAGTCATCAT TTTGTCATGGYAGATATGGAAATATCCGAAGTTATGGGTAGGATT

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.