Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_Ku_c23305_33210841

[Submit comment/correction]

Sequence	wsnp_Ku_c23305_33210841
Contig	2DS_5324607
Probe	wsnp_Ku_c23305_33210841
DNA Homology	2DS_5324607 Best IWGSC match 154 6e-35 URGI_Best IWGSC_N
BLAST, e-value	6e-35 2DS_5324607 Best IWGSC match
DNA	agtcatatgtgcaacagctagaaagcagcaagctgaagcttgcacaacta gagcaggagctccagaaagctcgccagcagggaatcttcatttctagctc Mggagaccaaacccatgccatgagtggaaatggagcaatgactttcgatc tggaatacactagatggcttgaggaccaaaacaagcaaatcaatgagttg a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.