Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: IACX8565

[Submit comment/correction]

Sequence	IACX8565
Contig	2BS_5162880
Probe	IACX8565
DNA Homology	2BS_5162880 Best IWGSC match 224 0 URGI_Best IWGSC_N
BLAST, e-value	0 2BS_5162880 Best IWGSC match
DNA	ggaggctgtaattgtcacaccaagcgtagaacctactgatggtggtagtg caacaatcgtgaaagatgaggagttgaatgatcctgctgtcaaagatccc Raggaagctaaagaactatctctnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn n

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.