Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 5BS_2294955

[Submit comment/correction]

Sequence	Kukri_c16760_259
Contig	5BS_2294955
Probe	Kukri_c16760_259
DNA Homology	5BS_2294955 Best IWGSC match 174 1.99993e-41 URGI_Best IWGSC_N
BLAST, e-value	1.99993e-41 5BS_2294955 Best IWGSC match
DNA	gtgccaccggacygtgtgccctgtccatcaaggatgagcgccctggagct Rtcaatgcgtaaatacgctgagcaacctgacaagaatgtggtccgacctg a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.