Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Jagger_c4412_103

[Submit comment/correction]

Sequence	Jagger_c4412_103
Contig	2BS_5247514
Probe	Jagger_c4412_103
DNA Homology	2BS_5247514 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value	2.94273e-44 2BS_5247514 Best IWGSC match
DNA	gatgacgaggttgaggaggagccagcaaaagaggaggtgatcaagcaagc Rccgatcaaagaagaaccgaaacctgaagtacaggaaagagaaaatgaga a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.